circad | circRNAs associated with diseases

Hsa_Circ_0001206
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Prostate Cancer	ICD-10	Malignant neoplasm of prostate (C61)
DBLink		PMID	31198063
Experimental Method
Sample Type	Tissue and cell lines	Comparison	PCa tissues and adjacent normal tissues were collected intraoperatively from 50 patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACCTGCTCATGCATACGCTC Reverse AGATCCCATTGGTGGGCTTG	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Song, Z, Zhuo, Z, Ma, Z, Hou, C, Chen, G, Xu, G (2019). Hsa_Circ_0001206 is downregulated and inhibits cell proliferation, migration and invasion in prostate cancer. Artif Cells Nanomed Biotechnol, 47, 1:2449-2464.